Google

Primer3 Input Help

Cautions

Some of the most important issues in primer picking can be addressed only before using Primer3. These are sequence quality (including making sure the sequence is not vector and not chimeric) and avoiding repetitive elements.

Techniques for avoiding problems include a thorough understanding of possible vector contaminants and cloning artifacts coupled with database searches using blast, fasta, or other similarity searching program to screen for vector contaminants and possible repeats. Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and others, 1995-1996, ftp://ncbi.nlm.nih.gov/repository/repbase) is an excellent source of repeat sequences and pointers to the literature. Primer3 now allows you to screen candidate oligos against a Mispriming Library (or a Mishyb Library in the case of internal oligos).

Sequence quality can be controlled by manual trace viewing and quality clipping or automatic quality clipping programs. Low- quality bases should be changed to N's or can be made part of Excluded Regions. The beginning of a sequencing read is often problematic because of primer peaks, and the end of the read often contains many low-quality or even meaningless called bases. Therefore when picking primers from single-pass sequence it is often best to use the Included Region parameter to ensure that Primer3 chooses primers in the high quality region of the read. In addition, Primer3 takes as input a Sequence Quality list for use with those base calling programs such as Phred (http://www.mbt.washington.edu/phrap_documentation.html) that output this information.

Source Sequence
The sequence from which to select primers or hybridization oligos.
Sequence Id
An identifier that is reproduced in the output to enable you to identify the chosen primers.
Targets
If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of
start,length
pairs where start is the index of the first base of a Target, and length is its length.
Excluded Regions
Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of
start,length
pairs where start is the index of the first base of the excluded region, and length is its length. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs.
Product Size
Minimum, Optimum, and Maximum lengths (in bases) of the PCR product. Primer3 will not generate primers with products shorter than Min or longer than Max, and with default arguments Primer3 will attempt to pick primers producing products close to the Optimum length,
Number To Return
The maximum number of primer pairs to return. Primer pairs returned are sorted by their "quality", in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time.
Max 3' Stability
The maximum stability for the five 3' bases of a left or right primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Rychlik recommends a maximum value of 9 (Wojciech Rychlik, "Selection of Primers for Polymerase Chain Reaction" in BA White, Ed., "Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications", 1993, pp 31-40, Humana Press, Totowa NJ).
Max Mispriming
The maximum allowed weighted similarity with any sequence in Mispriming Library. Default is 12.
Pair Max Mispriming
The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in Mispriming Library. Default is 24.
Primer Size
Minimum, Optimum, and Maximum lengths (in bases) of a primer oligo. Primer3 will not pick primers shorter than Min or longer than Max, and with default arguments will attempt to pick primers close with size close to Opt. Min cannot be smaller than 1. Max cannot be larger than 36. (This limit is governed by maximum oligo size for which melting-temperature calculations are valid.) Min cannot be greater than Max.
Primer Tm
Minimum, Optimum, and Maximum melting temperatures (Celsius) for a primer oligo. Primer3 will not pick oligos with temperatures smaller than Min or larger than Max, and with default conditions will try to pick primers with melting temperatures close to Opt.

Primer3 uses the oligo melting temperature formula given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.

Maximum Tm Difference
Maximum acceptable (unsigned) difference between the melting temperatures of the left and right primers.
Product Tm
The minimum, optimum, and maximum melting temperature of the amplicon. Primer3 will not pick a product with melting temperature less than min or greater than max. If Opt is supplied and the Penalty Weights for Product Size are non-0 Primer3 will attempt to pick an amplicon with melting temperature close to Opt.

Primer3 calculates product melting temperature using equation (iii) from Rychlik, Spencer and Rhoads, Nucleic Acids Research 18:21 pg. 6410.

Primer GC% Minimum, Optimum, and Maximum percentage of Gs and Cs in any primer.
Max Complementarity
The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between left and right primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment
5' ATCGNA 3'
   || | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
   ||  | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.
Max 3' Complementarity
The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between left and right primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example
5' ATGCCCTAGCTTCCGGATG 3'
             ||| |||||
          3' AAGTCCTACATTTAGCCTAGT 5'
or
5` AGGCTATGGGCCTCGCGA 3'
               ||||||
            3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Max Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5'->3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.
Max Poly-X
The maximum allowable length of a mononucleotide repeat, for example AAAAAA.
Included Region
A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form
start,length
where start is the index of the first base to consider, and length is the number of subsequent bases in the primer-picking region.
Start Codon Position
This parameter should be considered EXPERIMENTAL at this point. Please check the output carefully; some erroneous inputs might cause an error in Primer3. Index of the first base of a start codon. This parameter allows Primer3 to select primer pairs to create in-frame amplicons e.g. to create a template for a fusion protein. Primer3 will attempt to select an in-frame left primer, ideally starting at or to the left of the start codon, or to the right if necessary. Negative values of this parameter are legal if the actual start codon is to the left of available sequence. If this parameter is non-negative Primer3 signals an error if the codon at the position specified by this parameter is not an ATG. A value less than or equal to -10^6 indicates that Primer3 should ignore this parameter. Primer3 selects the position of the right primer by scanning right from the left primer for a stop codon. Ideally the right primer will end at or after the stop codon.
Mispriming Library
This selection indicates what mispriming library (if any) Primer3 should use to screen for interspersed repeats or for other sequence to avoid as a location for primers.
CG Clamp
Require the specified number of consecutive Gs and Cs at the 3' end of both the left and right primer. (This parameter has no effect on the hybridization oligo if one is requested.)
Salt Concentration
The millimolar concentration of salt (usually KCl) in the PCR. Primer3 uses this argument to calculate oligo melting temperatures.
Annealing Oligo Concentration
The nanomolar concentration of annealing oligos in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is "empirically determined". The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures.
Max Ns Accepted
Maximum number of unknown bases (N) allowable in any primer.
Liberal Base
This parameter provides a quick-and-dirty way to get Primer3 to accept IUB / IUPAC codes for ambiguous bases (i.e. by changing all unrecognized bases to N). If you wish to include an ambiguous base in an oligo, you must set Max Ns Accepted to a non-0 value. Perhaps '-' and '* ' should be squeezed out rather than changed to 'N', but currently they simply get converted to N's. The authors invite user comments.
First Base Index
The index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) In the WWW interface this parameter defaults to 1.
Inside Target Penalty
Non-default values valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and overlaps the target, then multiply this value times the number of nucleotide positions by which the primer overlaps the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Primer3 to include overlap with the target as a term in the objective function.
Outside Target Penalty
Non-default values valid only for sequences with 0 or 1 target regions. If the primer is part of a pair that spans a target and does not overlap the target, then multiply this value times the number of nucleotide positions from the 3' end to the (unique) target to get the 'position penalty'. The effect of this parameter is to allow Primer3 to include nearness to the target as a term in the objective function.
Show Debuging Info
Include the input to primer3_core as part of the output.

Sequence Quality

Sequence Quality
A list of space separated integers. There must be exactly one integer for each base in the Source Sequence if this argument is non-empty. High numbers indicate high confidence in the base call at that position and low numbers indicate low confidence in the base call at that position.
Min Sequence Quality
The minimum sequence quality (as specified by Sequence Quality) allowed within a primer.
Min 3' Sequence Quality
The minimum sequence quality (as specified by Sequence Quality) allowed within the 3' pentamer of a primer.
Sequence Quality Range Min
The minimum legal sequence quality (used for interpreting Min Sequence Quality and Min 3' Sequence Quality).
Sequence Quality Range Max
The maximum legal sequence quality (used for interpreting Min Sequence Quality and Min 3' Sequence Quality).

Penalty Weights

This section describes "penalty weights", which allow the user to modify the criteria that Primer3 uses to select the "best" primers. There are two classes of weights: for some parameters there is a 'Lt' (less than) and a 'Gt' (greater than) weight. These are the weights that Primer3 uses when the value is less or greater than (respectively) the specified optimum. The following parameters have both 'Lt' and 'Gt' weights:
  • Product Size
  • Primer Size
  • Primer Tm
  • Product Tm
  • Primer GC%
  • Hyb Oligo Size
  • Hyb Oligo Tm
  • Hyb Oligo GC%
The Inside Target Penalty and Outside Target Penalty are similar, except that since they relate to position they do not lend them selves to the 'Lt' and 'Gt' nomenclature.

For the remaining parameters the optimum is understood and the actual value can only vary in one direction from the optimum:

  • Primer Self Complementarity
  • Primer 3' Self Complementarity
  • Primer #N's
  • Primer Mispriming Similarity
  • Primer Sequence Quality
  • Primer 3' Sequence Quality
  • Primer 3' Stability
  • Hyb Oligo Self Complementarity
  • Hyb Oligo 3' Self Complementarity
  • Hyb Oligo Mispriming Similarity
  • Hyb Oligo Sequence Quality
  • Hyb Oligo 3' Sequence Quality
The following are weights are treated specially:
Position Penalty Weight
Determines the overall weight of the position penalty in calculating the penalty for a primer.
Primer Weight
Determines the weight of the 2 primer penalties in calculating the primer pair penalty.
Hyb Oligo Weight
Determines the weight of the hyb oligo penalty in calculating the penalty of a primer pair plus hyb oligo.
The following govern the weight given to various parameters of primer pairs (or primer pairs plus hyb oligo).
  • Tm difference
  • Primer-Primer Complementarity
  • Primer-Primer 3' Complementarity
  • Primer Pair Mispriming Similarity

Hyb Oligos (Internal Oligos)

Parameters governing choice of internal oligos are analogous to the parameters governing choice of primer pairs. The exception is Max 3' Complementarity which is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that Max 3' Complementarity be set at least as high as Max Complementarity.

Copyright Notice and Disclaimer

Copyright (c) 1996,1997,1998 Whitehead Institute for Biomedical Research. All rights reserved.

Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met:

  1. Redistributions must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. Redistributions of source code must also reproduce this information in the source code itself.
  2. If the program is modified, redistributions must include a notice (in the same places as above) indicating that the redistributed program is not identical to the version distributed by Whitehead Institute.
  3. All advertising materials mentioning features or use of this software must display the following acknowledgment:
    This product includes software developed by the Whitehead Institute for Biomedical Research.
  4. The name of the Whitehead Institute may not be used to endorse or promote products derived from this software without specific prior written permission.
We also request that use of this software be cited in publications as
Steve Rozen, Helen J. Skaletsky (1998) Primer3. Code available at http://www-genome.wi.mit.edu/genome_software/other/primer3.html.
THIS SOFTWARE IS PROVIDED BY THE WHITEHEAD INSTITUTE ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE WHITEHEAD INSTITUTE BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.

Acknowledgments

The development of Primer3 and the Primer3 web site was funded by Howard Hughes Medical Institute and by the National Institutes of Health, National Center for Human Genome Research. under grants R01-HG00257 (to David C. Page) and P50-HG00098 (to Eric S. Lander).

We gratefully acknowledge the support of Digital Equipment Corporation, which provided the Alphas which were used for much of the development of Primer3, and of Centerline Software, Inc., whose TestCenter memory-error, -leak, and test-coverage checker we use regularly to discover and correct otherwise latent errors in Primer3.


Original design of this primer-picking web site by Richard Resnick, who also is an author of this site\'s documentation.
Web software provided by Steve Rozen steve@genome.wi.mit.edu and Whitehead Institute/MIT Center for Genome Research.
Last modified: Tue Aug 25 19:53:27 EDT